PCR and qPCR

Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix, High ROX

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen High ROX qPCRMastermix

Pricing and Availability

Thermo Scientific™ 0.2 mL Strip Tubes

Optimize PCR and qPCR with these 0.2 mL strip tubes, available as 8 tubes per strip in several colors or 12 tubes per strip. X120 STRIP 8X0,2ML BLUE 10X12

Pricing and Availability

Thermo Scientific™ Phusion Buffers

Choose between two buffer packs to optimize high-fidelity PCR or difficult or long template amplification using Thermo Scientific™ Phusion™ High-Fidelity DNA Polymerases. Phusion HF Buffer Pack FP=2 x 1.5 ml

Pricing and Availability

Fisherbrand™ 96-Well Low-Profile, Skirted PCR Plates

Fit most thermal cyclers X25 Fisherbrand PCR plate 96-wells, full skirt, PP, red - FB-0800/R

Pricing and Availability

Thermo Scientific™ T4 DNA Polymerase

Ensure accuracy in DNA synthesis with template-dependent T4 DNA Polymerase that catalyzes the 5'-3' synthesis from primed single-stranded DNA. T4 DNA POL 5U/UL 100U

Pricing and Availability

Fisher BioReagents™ exACTGene™ Control Primers

Optimized for routine PCR applications 100UL Control Primer no. 3, for use with Fisher BioReagents exACTGene PCR Kit

Pricing and Availability

Thermo Scientific™ Armadillo™ 384-Well PCR Plates

Optimize high throughput robotic PCR and qPCR applications with these uItra-rigid 384-well PCR plates with poylcarbonate frames and polypropylene wells. X50 PLATE PCR 384 CLR WELLS GRN

Pricing and Availability

Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen qPCR MM (2x)

Pricing and Availability

Fisherbrand™ 0.2mL PCR Tube Strips

Ideal for use in 0.2mL, 96-well V-bottom thermal cyclers X250 PCR 8-tubes 0.2ml strip w/domed cap, PP,natural, FB-0266

Pricing and Availability

Thermo Scientific™ Thermo-Fast™ 96-Well Full-Skirted Plates

96-well full-skirted PCR automation compatible plate for use in PCR and qPCR applications. X25 THERMOFAST SK 96X0,2ML GREENgreen (VE=25Stck.)

Pricing and Availability

Thermo Scientific™ Armadillo™ 96-Well PCR Plate

Optimize robotic applications with these ultra-rigid 96-well PCR plates with U-bottom wells, available in various colors. X25 PLATE PCR 96 WH WELLS GRN COD

Pricing and Availability

Thermo Scientific™ DreamTaq Green PCR Master Mix (2X) Promotion

Contains green buffer that includes density reagent and two tracking dyes for direct loading of PCR products on gels X4 Routine PCR, PCR master mixes, DreamTaq(TM) (MP 52 PROMO)

Pricing and Availability

Thermo Scientific™ 96-Well Non-Skirted Plates

96-well non-skirted plates for use in PCR and qPCR applications. Available with black lettering for improved sample tracking during pipetting. X25 THERMOFAST 96X0,2ML BLACK(VE=25Stck.)

Pricing and Availability

Thermo Scientific™ pJET1.2 Sequencing Primers

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store

Pricing and Availability

Thermo Scientific™ 96-Well Non-Skirted Plates, Low Profile

Low profile 96-well plates for use in PCR and qPCR applications. X25 Plate Thermo Scientific Abgene ThermoFast(R)

Pricing and Availability

Thermo Scientific™ Verso One-Step RT-qPCR Kit, SYBR Green, ROX

The Verso RT enzyme delivers high processivity and can be used at temperatures up to 57°C, delivering effective transcription through difficult RNA secondary structures. 200RXN VERSO SYBR GREEN 1-STEP QRT

Pricing and Availability

Fisherbrand™ Anodized Aluminum Blocks

Useful for a variety of applications in molecular biology, histology, clinical, environmental and industrial settings. Fisherbrand™ Anodized Aluminum Blocks are for use with Fisherbrand Digital Block Heaters.
BLOCK 24 TUBES EPP 1,5ML

Pricing and Availability

Thermo Scientific™ 0.1 mL Individual UTW Tubes

Reduce incubation times during PCR with these ultra-thin wall individual PCR tubes with attached flat caps. PCR TUBE W/CLR CAP,WHITE 960/CS, VE=960 St.

Pricing and Availability

Thermo Scientific™ Taq DNA Polymerase, Recombinant

Optimize routine PCR with this highly thermostable DNA polymerase. X20 PCR MASTER MIX 1.25ML

Pricing and Availability

Eppendorf™ PCR Tubes

Ensure efficient heat transfer to the sample with these tubes, thanks to their thin, even wall thickness and smooth wall surface. Eppendorf™ PCR Tubes are easy to open, but provide tight sealing to prevent evaporation in PCR. X500 Tubes PCR thin-walled 0.5mL (pack of 500)

Pricing and Availability

Thermo Scientific™ DreamTaq™ Hot Start Green PCR Master Mix

Thermo Scientific DreamTaq Hot Start DNA Polymerase is the product of choice when you need consistently robust amplification with minimal optimization steps 1000RXN DREAMTAQ HS GREEN MASTER MIX

Pricing and Availability

Thermo Scientific™ Phire Plant Direct PCR Master Mix

Amplify DNA directly from plant samples without prior DNA purification with Phire Plant Direct PCR Master Mix Phire Plant Direct PCR MM

Pricing and Availability

Eppendorf™ Cable

Cable Eppendorf for mastercycler ep 150cm

Pricing and Availability

Thermo Scientific™ Phusion™ Flash High-Fidelity PCR Master Mix Promotion

Perform short PCR protocols without compromising fidelity or yield with this master mix. PHUSION FLASH MASTERMIX 100 RXNS (MP 52 PROMO)

Pricing and Availability

Thermo Scientific™ ABsolute™ qPCR Mix, SYBR Green, ROX

Optimized for SYBR Green chemistry and contains all the components necessary to perform quantitative PCR, with the exception of template and primers. AB-1162/b Absolute QPCR SYBR Green Rox (500nm)

Pricing and Availability

Thermo Scientific™ VersiPlate™ 96-well PCR Plates and Frames

Flexible 96-well plates of low profile strip tubes for use in PCR and qPCR applications. VersiPlate, 96-well PCR Plate

Pricing and Availability

Thermo Scientific™ Phusion High-Fidelity DNA Polymerase Promotion

Get superior performance for cloning and other applications requiring high fidelity with one of the most accurate thermostable DNA polymerases available. 1 SET PHUSION HIGH-FIDELITY PCR MASTER MIX HF (MP52 PROMO)

Pricing and Availability

Eppendorf™ ThermoStat™ C

Use this temperature control device for heating and cooling almost any of your lab vessels. The Eppendorf ThermoStat™ C is the ideal device to accurately set and maintain temperatures. THERMOSTAT C W/O THERMOBLOCK, SMARTBLOCK 220-240V

Pricing and Availability

Eppendorf™ Spacer

SPACER FOR MASTERCYCLER EP, VERSION 384

Pricing and Availability

One moment while we fetch your results  spinner