Oligonucleotides
Thermo Scientific™ Primers for cDNA Synthesis
Optimze cDNA synthesis with these random hexamer primers, oligo(dT)18 primers and anchored oligo dT primers. 120 UL RANDOM HEXAMER PRIMER, 100µM 120µL STOREat -20°C
Invitrogen™ Oligo(dT) 12-18 Primer
Primer is suitable for use in first-strand cDNA synthesis with reverse transcriptase Oligo(dT)12 18 Primer, 25 µg
Applied Biosystems™ Random Hexamers (50mM)
Serve as primers for DNA synthesis by a DNA polymerase or reverse transcriptase 1 SET Random Hexamers (50um) 1kit Store at -20 C
Applied Biosystems™ 5' Fluorescent Labeled Single Primers
Custom 5' labeled primers are fluorescently labeled oligos with a choice of dye on the 5' end TA PCRII DUAL PROMOTER
Thermo Scientific™ M13/pUC sequencing primer (-20), 17-mer
Accurately sequence DNA with M13 pUC sequencing primers, single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. 6 NMOL M13/PUC SEQUENCING PRIMER (-20), 17-MER,5'-d(GTAAAACGACGGCCAGT)-3', 10µm, 6nmol Store at
Invitrogen™ M13 Reverse
Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13 REVERSE
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 24-MER 10UM 4.2NMOL
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T7 PRIMER 20-MER 10UM 5NMOL
Invitrogen™ T7 Promoter Primer
Primers for PCR amplification that complement many vectors PRIMER, T7Invitrogen offers primers for PCR amplification
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL
Invitrogen™ Anchored Oligo(dT) 20 Primer
Primer mixture consisting of a string of 20 deoxythymidylic acid residues followed by dV (either dG, dA, or dC) and then by dN (dA, dT, dG, or dC) ANCHORED OLIGO(DT) 20 PRIM50UG
Invitrogen™ M13 Forward (-20)
Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13(-20)FORWARD
Thermo Scientific™ M13/pUC reverse sequencing primer (-46), 24-mer
Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC REV -46 10UM 4.2NMOL
Thermo Scientific™ M13/pUC sequencing primer (-46), 22-mer
Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC PRIM -46 10UM 4.5NMOL
Invitrogen™ RNA Century™-Plus Marker Templates
Contain mixtures of linearized plasmids ready for use as templates during in vitro transcription reactions for synthesis of labeled RNA molecular size standards 5 UG CENTURY-PLUS MARKER TEMPLATES 5µG STORE AT-20 C
Thermo Scientific™ pJET1.2 Sequencing Primers
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store
Invitrogen™ 5-(3-Aminoallyl)-UTP (50mM)
Ambion Modified nucleotides confer unique characteristics to the RNA molecules into which they are incorporated 50MM 5-(3-AMINOALLYL)-UTP 50ULAmbion® Modified nucleotides confer unique
Invitrogen™ Random Decamers (50μM)
Provided at a stock concentration of 50μM, and functionally tested using the RETROscript™ Kit 80 UL RANDOM DECAMERS (50 UM) 80µL STORE AT -20 C
Thermo Scientific™ M13/pUC reverse sequencing primer (-26), 17-mer
Sequence DNA fragments inserted into the MCS of various pUC19-based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC REVERSE SEQUENCING PRIMER (-26),17-mer 5'-d(CAGGAAACAGCTATGAC)-3', 10µm, 6nmol
Thermo Scientific™ Oligo(dT)18 Primers
Thermo Scientific™ Oligo(dT)18 Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. 120 UL OLIGO(DT)18 PRIMER, 100µM 120µL STORE AT-20°C
Invitrogen™ RNA Century™ Marker Templates
Contain mixtures of linearized plasmids ready for use as templates as part of in vitro transcription reactions for synthesis of labeled RNA molecular size standards 5 UG CENTURY MARKER TEMPLATES 5µG STORE AT -20 C
Thermo Scientific™ M13/pUC sequencing primer (-40), 17-mer
Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC SEQUENCING PRIMER (-40), 17-MER,5'-d(GTTTTCCCAGTCACGAC)-3', 10µm, 6nmol Store at
Invitrogen™ Bio-16-UTP (10mM)
Ideal for use as substrates as part of in vitro transcription reactions 25 UL BIO-16-UTP 25µL STORE AT -80°C
Invitrogen™ Bio-11-UTP (75mM)
Ideal for use as substrates as part of in vitro transcription reactions 30 UL BIO-11-UTP 30µL STORE AT -80°C
Thermo Scientific™ Exo-Resistant Random Primer
Perform highly efficient random priming of DNA synthesis reactions with this mixture of single-stranded random oligonucleotides. 100 UL EXO-RESISTANT RANDOM PRIMER, 5'-NPNPNPNPNPSNpSN-3', 500µm 100µL Store at -20°C
Invitrogen™ Random Primers
Truly random primers suitable for DNA synthesis using Klenow fragments with DNA templates or for cDNA synthesis using reverse transcriptase with mRNA templates RANDOM PRIMERS,1.5MM 9 units
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 18-MER 10UM 5.6 NMOL
Invitrogen™ Bio-11-UTP (10mM)
Ideal for use as substrates as part of in vitro transcription reactions 25 UL BIO-11-UTP 25µL STORE AT -80°C
Invitrogen™ Lambda Hind III dsDNA Markers
Ambion Lambda DNA is digested to completion with Hind III 0.5 MG LAMBDA DNA - HIND III DIGESTED 0.5MG STOREat -20°C
Invitrogen™ 5-(3-Aminoallyl)-dUTP (50mM)
When incorporated into DNA, 5-(3-aminoallyl)-dUTP provides a reactive group for addition of other chemical groups 50MM 5-(3-AMINOALLYL)-UTP 5ULAmbion® Modified nucleotides confer unique