missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO114
29.13 EUR valid until 2024-12-31
Use promo code "21651" to get your promotional price.
This item is not returnable.
View return policy
Description
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
Specifications
| Sequencing Primer | |
| Dry Ice | |
| M13 | |
| pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II | |
| Liquid |
| M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL) Store at –20°C. |
|
| 10 μM | |
| 10 μM, 45 μL | |
| Sequencing |
Product Content Correction
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
Product Title
For Research Use Only. Not for use in diagnostic procedures.
Spot an opportunity for improvement?Share a Content Correction